 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0007385 | |||
| Gene | MEMO1 | Organism | Human |
| Genome Locus | chr2:32142994-32157204:- | Build | hg19 |
| Disease | Non-Small cell Lung Cancer tumorigenesis | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
| DBLink | Link to database | PMID | 29372377 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | Pairs of Non-Small cell Lung Cancer tumorigenesis (NSCLC) tissue and adjacent non-cancerous lung tissue was excised from patients and immediately frozen for further analysis. |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward CGTGACCCAGAAGTGCGTTCACA ReverseTGGGGGTGTATCAGTCTTTGGTT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Jiang, MM, Mai, ZT, Wan, SZ, Chi, YM, Zhang, X, Sun, BH, Di, QG (2018). Microarray profiles reveal that circular RNA hsa_circ_0007385 functions as an oncogene in non-small cell lung cancer tumorigenesis. J. Cancer Res. Clin. Oncol., 144, 4:667-674. | |||